Expression Disruption Screen

Methods & Protocols

A) The ED screen:

This screen was performed by injecting a mix of the ED vector with Tol2 mRNA in one cell stage zebrafish embryos (1). Injected embryos showing broad and patchy expression of GFP and RFP were grown to adults and out-crossed with wild type zebrafish. Embryos from this cross were screened for GFP and/or RFP expression (2). Different expression patterns corresponding to different ED insertions were documented. Some expression patterns were selected to establish stable transgenic lines by growing F1 embryos to adults (3). F1 adults from successfully established lines were out-crossed with wild type zebrafish. F2 embryos were selected for GFP and/or RFP expression and part of them were used to map the ED insertions by inverse PCR (4). The rest of the embryos were grown to adults and in-crossed to screen for mutants in F3 embryos (5).

B) Map of ED insertions:

B1) Genomic extraction:

• Select 5 embryos with the same expression pattern.
• Transfer each embryo into a 1.5ml microcentrifuge tube and wash it using about 1ml of ddH2O.
• Add 50ul of genomic extraction buffer (10mM Tris pH8.2, 10mM EDTA, 200mM NaCl, 0.5% SDS and 200ug/ml proteinase K) and incubate 3h at 56oC vortexing in between.
• Add 100ul of Ethanol 100% and place at -20oC over night.
• Centrifuge for 10 min at 13000 rpm.
• Remove supernatant.
• Add 200 ul of Ethanol 70% and briefly vortex.
• Spin again 2 min, remove supernatant and dry the pellet.
• Re-suspend the DNA in 20ul of TE+RNAse buffer (10mM Tris, 1mM EDTA pH8, 100ug/ml RNAse) and incubate 1h at 37oC.
• Store the genomic DNA at -20oC.

B2) Sau3 A1 digestion:

• Transfer 5ul of DNA into a new 1.5ml microcentrifuge tube and add 2ul of restriction enzyme buffer, 0.66 ul of Sau3 AI (4U/ul, Roche) or another suitable enzyme and ddH2O to a final reaction volume of 20ul.
• Incubate over night at 37oC (2h will be enough).
• Run in a gel 3ul of the digestion. A smear is expected.
• Inactivate Sau3AI restriction enzyme by incubating 30min at 67oC.

B3) Ligation:

• Add 10ul of ddgation buffer, 0,66ul of T4 ddgase (2U, Promega) and ddH2O to a total reaction volume of 100ul.
• Incubate over night at 16oC.

B4) Precipitation of the ligation:

• Add 10ul of AcNa (3M, pH=5.2) and 220ul of cold ethanol (100%).
• Place 2h at -80oC. -Spin 12min at 11000rpm.
• Remove supernatant with careful and dry the pellet.
• Re-suspend in 6ul of ddH2O.

B5) Inverse PCR:

• Amplify through two PCR rounds using 1ul of the ligation. After the first PCR, add 200ul of ddH2O to the PCR product and use 1ul to perform the second PCR. Perform a PCR reaction per each tip of the Tol2 transposon, here named GFP or RFP, using specific primers for each tip. Use PCR programs and primers as follows:



• PCR programs:


• GFP side PCR1 (Primers 5TolF1 and 5TolR1):
  1X(95ºC, 2min); 30X(95ºC, 15sec; 49ºC, 30sec; 72ºC, 1min) ; 1X(72ºC, 5min); 1X(4ºC, Hold).



• GFP side PCR2 (Primers 5TolF2 and 5TolR2):
  1X(95ºC, 2min); 30X(95ºC, 15sec; 51ºC, 30sec; 72ºC, 1min); 1X(72ºC, 5min); 1X(4ºC, Hold).



• RFP side PCR1 (Primers 3TolF1 and 3TolR1):
  1X(95ºC, 2min ); 30X(95ºC, 15sec ; 43ºC, 30sec; 72ºC, 2min ); 1X(72ºC, 5min); 1X(4ºC, Hold).



• RFP side PCR2 (Primers 3TolF2 and 3TolR2 or 3TolTest):
  1X(95ºC, 2min); 30X(95ºC, 15sec ; 45ºC, 30sec ; 72ºC, 2min ); 1X(72ºC, 5min); 1X(4ºC, Hold).



• Primers:


• GFP side:
• 5TolF1 CTTGAGTACAATTAAAAATCAATAC
• 5TolR1 GTAAAAATCCCCAAAAATAATAC
• 5TolF2 CTCCTTACAATTTTATTTACAGTC
• 5TolR2 GTAAAATTACTCAAGTACTTTACACC



• RFP side:
• 3TolF1 TTTACTCAAGTAAGATTCTAG
• 3TolR1 CTCCATTAAAATTGTACTTG
• 3TolF2 ACTTGTACTTTCACTTGAGTA
• 3TolR2 GCAAGAAAGAAAACTAGAGA
• 3TolTest GATATCCATGGAATTCACTAGTGCG

B6) Purification, cloning and transformation of the PCR product:

• Run the second PCR product in a 2% agarose gel.
• For each tip of the transposon cut a band common to the 5 embryos from the same ED line.
• Extract the DNA from the agarose.
• Clone the purified DNA into a vector.
• We use the pCR 8/GW/TOPO TA vector (Invitrogen).

B7) Colony confirmation PCR:

• Perform a colony PCR using the PCR2 primers and protocols.
• Run the PCR product in a 2% % agarose gel.
• Select a positive colony and grow it over night in LB with an antibiotic compatible with the cloning vector.

B8) Plasmid recovery:

• Recover plasmid DNA using a commercial plasmid recovery kit.

B9) Insert confirmation:

• Digest 3 ul of the plasmid DNA with suitable restriction enzymes to confirm the presence of the insert (30 min @ 37oC will be enough).
• For the pCR 8/GW/TOPO TA vector we use EcoRI for the GFP and RFP side inserts. EcoRI flanks the TOPO cloning site, therefore the insert is released. We also digest the RFP side clones with XbaI, which cuts once in the insert and once in the vector.

C) Vectors used in the ED screen:

The majority of the ED lines were generated using the vector IIC (ED48 to ED272). IIC sequence is available here. Previous versions of this vector, IMP16, IMP17 and IMPCherry were also used to generate ED1 to ED47 lines. These lines didn't show RFP expression pointing to a limited activity of the meis1 minimal promoter.